ID: 1151473339_1151473355

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1151473339 1151473355
Species Human (GRCh38) Human (GRCh38)
Location 17:74331347-74331369 17:74331394-74331416
Sequence CCTGAGTGGGGAGAGGTGGACCG GGCCACCGTGAGGGGTCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 215} {0: 1, 1: 0, 2: 4, 3: 13, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!