ID: 1151535986_1151535994

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1151535986 1151535994
Species Human (GRCh38) Human (GRCh38)
Location 17:74738950-74738972 17:74738976-74738998
Sequence CCCTCCTCCTTCTACCCACTATG ACCATGCCACAGAAAGGTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 352} {0: 1, 1: 0, 2: 3, 3: 19, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!