ID: 1151540778_1151540788

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1151540778 1151540788
Species Human (GRCh38) Human (GRCh38)
Location 17:74763641-74763663 17:74763660-74763682
Sequence CCCTCCTCCTCCTTCATGGGAGG GAGGCCCAGAGGTGTGGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 47, 4: 366} {0: 1, 1: 0, 2: 10, 3: 46, 4: 504}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!