ID: 1151541620_1151541628

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1151541620 1151541628
Species Human (GRCh38) Human (GRCh38)
Location 17:74767652-74767674 17:74767678-74767700
Sequence CCATCCACCTTCTTCTTTCAAGG TCCTTTGCTGCTTCAGGGTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 472} {0: 1, 1: 0, 2: 4, 3: 28, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!