ID: 1151542633_1151542644

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1151542633 1151542644
Species Human (GRCh38) Human (GRCh38)
Location 17:74772503-74772525 17:74772547-74772569
Sequence CCTCATGGGGATAGTCAGTAGCC ATGAAGGAGCAGAAACAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 53} {0: 1, 1: 0, 2: 6, 3: 72, 4: 795}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!