ID: 1151561475_1151561484

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1151561475 1151561484
Species Human (GRCh38) Human (GRCh38)
Location 17:74872206-74872228 17:74872255-74872277
Sequence CCAACAGAAGCTGGAACTTCCCA TCTCTTGTTCCTCAAGGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 206} {0: 1, 1: 0, 2: 3, 3: 21, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!