ID: 1151565202_1151565211

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1151565202 1151565211
Species Human (GRCh38) Human (GRCh38)
Location 17:74893700-74893722 17:74893721-74893743
Sequence CCTGGGGACACCCGCCCCCGGGG GGTCAAGGTGCGAGACACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 244} {0: 1, 1: 0, 2: 0, 3: 10, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!