ID: 1151605294_1151605303

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1151605294 1151605303
Species Human (GRCh38) Human (GRCh38)
Location 17:75131650-75131672 17:75131699-75131721
Sequence CCTCGAAGTCGGCCAGGACGCCG CCGCGCCATCGCCGCCGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 37} {0: 1, 1: 0, 2: 1, 3: 15, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!