ID: 1151660581_1151660599

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1151660581 1151660599
Species Human (GRCh38) Human (GRCh38)
Location 17:75516176-75516198 17:75516218-75516240
Sequence CCTTCTGCCCTCCTTGCCCAGCC AGCGCGAGGCTGCAGAGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 127, 4: 1084} {0: 1, 1: 0, 2: 0, 3: 20, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!