ID: 1151668276_1151668287

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1151668276 1151668287
Species Human (GRCh38) Human (GRCh38)
Location 17:75557945-75557967 17:75557988-75558010
Sequence CCAGGGATCAGGTCACTGGCCTG CTGTGTCTCCTCCCCACCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 408} {0: 1, 1: 0, 2: 7, 3: 46, 4: 451}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!