ID: 1151680250_1151680260

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1151680250 1151680260
Species Human (GRCh38) Human (GRCh38)
Location 17:75619311-75619333 17:75619344-75619366
Sequence CCCCCTCTGTGTGAGCAGAGGGC CTTCCTGCCCACAGGAGGCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 34, 4: 329}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!