ID: 1151688200_1151688206

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1151688200 1151688206
Species Human (GRCh38) Human (GRCh38)
Location 17:75662277-75662299 17:75662295-75662317
Sequence CCTTCCACAGGATCCAGAACAAG ACAAGGAAACCCTGGTAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 18, 4: 194} {0: 1, 1: 0, 2: 0, 3: 15, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!