ID: 1151702542_1151702552

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1151702542 1151702552
Species Human (GRCh38) Human (GRCh38)
Location 17:75751013-75751035 17:75751059-75751081
Sequence CCTCCACGGTGACCCAGCTGAGC CGGTGAGATCACAGCCTACGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 175} {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!