ID: 1151713223_1151713226

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1151713223 1151713226
Species Human (GRCh38) Human (GRCh38)
Location 17:75818391-75818413 17:75818406-75818428
Sequence CCAGGCCCTGTACTCGCTTCTCT GCTTCTCTCTTCCCTGCTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 223} {0: 1, 1: 0, 2: 5, 3: 31, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!