ID: 1151718232_1151718237

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1151718232 1151718237
Species Human (GRCh38) Human (GRCh38)
Location 17:75842397-75842419 17:75842435-75842457
Sequence CCTGGATAGAGTGGGGGCTGGAG GATGAAGGTCTCGTCCCAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 320} {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!