ID: 1151777298_1151777306

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1151777298 1151777306
Species Human (GRCh38) Human (GRCh38)
Location 17:76214114-76214136 17:76214162-76214184
Sequence CCTGGGGCTTGCGATGGGCATCA TGCACCCTCAACCTGTGGGATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 18, 3: 48, 4: 220} {0: 1, 1: 0, 2: 0, 3: 18, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!