ID: 1151797810_1151797821

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1151797810 1151797821
Species Human (GRCh38) Human (GRCh38)
Location 17:76358134-76358156 17:76358165-76358187
Sequence CCCCTCCCACAGAAGCATTGCAG GTACCTGAGGAGGGAAGTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 190} {0: 1, 1: 0, 2: 5, 3: 36, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!