ID: 1151802062_1151802070

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1151802062 1151802070
Species Human (GRCh38) Human (GRCh38)
Location 17:76384564-76384586 17:76384583-76384605
Sequence CCACCCCCGGGAGCGCGGGGCGG GCGGAGCCAGGCCGGCGCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 277} {0: 1, 1: 0, 2: 1, 3: 23, 4: 323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!