ID: 1151812587_1151812597

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1151812587 1151812597
Species Human (GRCh38) Human (GRCh38)
Location 17:76453138-76453160 17:76453178-76453200
Sequence CCATAACTGCTCTGCGCGAGTCT AGCGGCGGCGAACGAGGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 38} {0: 1, 1: 0, 2: 0, 3: 11, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!