ID: 1151819460_1151819468

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1151819460 1151819468
Species Human (GRCh38) Human (GRCh38)
Location 17:76489859-76489881 17:76489896-76489918
Sequence CCAGGAAAGGGTGTAGCTAGGAC TCCAGGGCCTGGAGGCTCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 95} {0: 1, 1: 1, 2: 3, 3: 49, 4: 377}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!