ID: 1151826522_1151826530

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1151826522 1151826530
Species Human (GRCh38) Human (GRCh38)
Location 17:76527125-76527147 17:76527150-76527172
Sequence CCCTTGGTAGTGGGACAGGGGAT GGCGCCCTTGGTAGTGGGACAGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 0, 3: 1, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!