ID: 1151828332_1151828340

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1151828332 1151828340
Species Human (GRCh38) Human (GRCh38)
Location 17:76535884-76535906 17:76535928-76535950
Sequence CCAAGGTCCTGAGGACCCTGCCT GAGTGTGCCAGACGCATGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 308} {0: 1, 1: 0, 2: 1, 3: 3, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!