ID: 1151917863_1151917868

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1151917863 1151917868
Species Human (GRCh38) Human (GRCh38)
Location 17:77131979-77132001 17:77132010-77132032
Sequence CCCGAAGTTTTCCCAGGTCGGGA CTGTGTTAGCTCAAGGCCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75} {0: 1, 1: 0, 2: 2, 3: 37, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!