ID: 1151925668_1151925674

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1151925668 1151925674
Species Human (GRCh38) Human (GRCh38)
Location 17:77194429-77194451 17:77194445-77194467
Sequence CCTGTAGTCCCAGCTACTGGGGA CTGGGGAGGCTGAGGTAGGATGG
Strand - +
Off-target summary {0: 3999, 1: 108004, 2: 233354, 3: 246148, 4: 165777} {0: 5, 1: 90, 2: 940, 3: 3161, 4: 6572}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!