|
Left Crispr |
Right Crispr |
Crispr ID |
1151925668 |
1151925674 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:77194429-77194451
|
17:77194445-77194467
|
Sequence |
CCTGTAGTCCCAGCTACTGGGGA |
CTGGGGAGGCTGAGGTAGGATGG |
Strand |
- |
+ |
Off-target summary |
{0: 3999, 1: 108004, 2: 233354, 3: 246148, 4: 165777} |
{0: 5, 1: 90, 2: 940, 3: 3161, 4: 6572} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|