ID: 1151943460_1151943467

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1151943460 1151943467
Species Human (GRCh38) Human (GRCh38)
Location 17:77306684-77306706 17:77306707-77306729
Sequence CCTGGTGTAGGGAAACCCTGATT CATAAGACGGGTGGACATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 130} {0: 1, 1: 0, 2: 1, 3: 10, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!