ID: 1151953087_1151953097

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1151953087 1151953097
Species Human (GRCh38) Human (GRCh38)
Location 17:77366012-77366034 17:77366059-77366081
Sequence CCAGGACACCAAGGGCCCCAGGG TGAGTTCTAGCCAAGCCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 372} {0: 1, 1: 0, 2: 2, 3: 7, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!