ID: 1152058651_1152058658

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1152058651 1152058658
Species Human (GRCh38) Human (GRCh38)
Location 17:78052066-78052088 17:78052118-78052140
Sequence CCTGTGTCCAGCAGGACAAGGGC GGAAAGAGCGCTGCACAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 203} {0: 1, 1: 0, 2: 3, 3: 10, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!