ID: 1152080392_1152080400

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1152080392 1152080400
Species Human (GRCh38) Human (GRCh38)
Location 17:78183820-78183842 17:78183840-78183862
Sequence CCCTCTTCCCTCCCTAAACAGAG GAGAAAGACAAAGTGAGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 421} {0: 1, 1: 0, 2: 8, 3: 94, 4: 1202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!