ID: 1152180525_1152180528

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1152180525 1152180528
Species Human (GRCh38) Human (GRCh38)
Location 17:78818145-78818167 17:78818178-78818200
Sequence CCATATTTCATAAAAAGCCAGAG CACCTGTTCTAGACATCAAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 45, 4: 457} {0: 1, 1: 0, 2: 1, 3: 9, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!