|
Left Crispr |
Right Crispr |
| Crispr ID |
1152182204 |
1152182208 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:78829822-78829844
|
17:78829849-78829871
|
| Sequence |
CCTCCGCCTGCCGGGTTTAAGCA |
TCCTGCCTCAGCCTCCCAAGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 214, 2: 6945, 3: 41384, 4: 107457} |
{0: 1238, 1: 2966, 2: 4676, 3: 5001, 4: 5368} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|