ID: 1152227315_1152227321

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1152227315 1152227321
Species Human (GRCh38) Human (GRCh38)
Location 17:79098464-79098486 17:79098481-79098503
Sequence CCCTCCCCATTTTGCAGATGAAG ATGAAGAAACAGCCCTGGAGAGG
Strand - +
Off-target summary {0: 2, 1: 13, 2: 83, 3: 327, 4: 973} {0: 1, 1: 1, 2: 6, 3: 69, 4: 525}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!