ID: 1152267479_1152267484

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1152267479 1152267484
Species Human (GRCh38) Human (GRCh38)
Location 17:79304769-79304791 17:79304791-79304813
Sequence CCCGGGGCCTCTGTTCTTGGTTC CCAACTCTAAGATTCTCGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 325} {0: 1, 1: 0, 2: 0, 3: 7, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!