ID: 1152303551_1152303557

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1152303551 1152303557
Species Human (GRCh38) Human (GRCh38)
Location 17:79508770-79508792 17:79508789-79508811
Sequence CCTGCTGCTGCCAGCACAGCCAT CCATGTGTCCCCAGGGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 49, 4: 449} {0: 1, 1: 0, 2: 6, 3: 63, 4: 298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!