ID: 1152381055_1152381067

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1152381055 1152381067
Species Human (GRCh38) Human (GRCh38)
Location 17:79942425-79942447 17:79942473-79942495
Sequence CCAGGCTGCTGTGACATCCAGAG CGGGCTGCTGCTGCTCTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 274} {0: 1, 1: 0, 2: 4, 3: 35, 4: 412}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!