ID: 1152382318_1152382329

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1152382318 1152382329
Species Human (GRCh38) Human (GRCh38)
Location 17:79948513-79948535 17:79948550-79948572
Sequence CCAGCCTCTGGCTCTGTGTGGCT CCACCCACGGGGAGATGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 82, 4: 1056} {0: 1, 1: 0, 2: 1, 3: 8, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!