ID: 1152399788_1152399794

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1152399788 1152399794
Species Human (GRCh38) Human (GRCh38)
Location 17:80058993-80059015 17:80059018-80059040
Sequence CCCGCAGCTCTCAGTGTTCGACC CCAGTGAGTGTCCACGCACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 77} {0: 1, 1: 0, 2: 0, 3: 7, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!