ID: 1152438016_1152438026

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1152438016 1152438026
Species Human (GRCh38) Human (GRCh38)
Location 17:80288069-80288091 17:80288084-80288106
Sequence CCCCCTGCAGGCCCAGGCTTTGG GGCTTTGGGAGAGGCAGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 66, 4: 433} {0: 1, 1: 0, 2: 13, 3: 160, 4: 899}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!