ID: 1152439234_1152439240

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1152439234 1152439240
Species Human (GRCh38) Human (GRCh38)
Location 17:80295289-80295311 17:80295304-80295326
Sequence CCCACACTGCGGTGCAGCCTGGG AGCCTGGGTGGGTTTCAGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 249, 4: 7008} {0: 1, 1: 1, 2: 4, 3: 30, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!