ID: 1152467884_1152467890

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1152467884 1152467890
Species Human (GRCh38) Human (GRCh38)
Location 17:80476045-80476067 17:80476060-80476082
Sequence CCCGAGTTGGCTGAGCGTCTCGG CGTCTCGGCGGCCGGTGTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 34} {0: 1, 1: 0, 2: 0, 3: 3, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!