ID: 1152490840_1152490849

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1152490840 1152490849
Species Human (GRCh38) Human (GRCh38)
Location 17:80632298-80632320 17:80632324-80632346
Sequence CCTTCCTCATGCGGATCCCTGTG GCTCCGGGGACGGGACGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 163} {0: 1, 1: 0, 2: 0, 3: 15, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!