ID: 1152560417_1152560427

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1152560417 1152560427
Species Human (GRCh38) Human (GRCh38)
Location 17:81075835-81075857 17:81075872-81075894
Sequence CCAGCCACAGGCTCCATATGAGG CCATCTCTGTCCTGGCACGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 148} {0: 1, 1: 0, 2: 4, 3: 52, 4: 473}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!