ID: 1152561944_1152561953

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1152561944 1152561953
Species Human (GRCh38) Human (GRCh38)
Location 17:81083034-81083056 17:81083075-81083097
Sequence CCTGGAAGGGCGAGAGGACCCGG ACTCAGCTGTGCTTTGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 165} {0: 1, 1: 0, 2: 1, 3: 23, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!