ID: 1152566612_1152566623

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1152566612 1152566623
Species Human (GRCh38) Human (GRCh38)
Location 17:81103199-81103221 17:81103221-81103243
Sequence CCCTGTCCGTTCCTCCTTCCTCC CAGGCCCTGATGGGCCCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 102, 4: 1029} {0: 1, 1: 0, 2: 0, 3: 23, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!