ID: 1152573408_1152573424

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1152573408 1152573424
Species Human (GRCh38) Human (GRCh38)
Location 17:81130212-81130234 17:81130240-81130262
Sequence CCCTCCTGCCTCTGTGTTCCCAG CTGGGGGTGGGCAGTGATGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 93, 4: 761} {0: 1, 1: 1, 2: 11, 3: 131, 4: 931}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!