|
Left Crispr |
Right Crispr |
Crispr ID |
1152577191 |
1152577192 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:81147648-81147670
|
17:81147661-81147683
|
Sequence |
CCGGAGGCTGAGGTCGGAGGATC |
TCGGAGGATCGCTTAAGCCCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 428, 2: 1448, 3: 4840, 4: 8339} |
{0: 2, 1: 221, 2: 5459, 3: 35010, 4: 90671} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|