ID: 1152594471_1152594481

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1152594471 1152594481
Species Human (GRCh38) Human (GRCh38)
Location 17:81231730-81231752 17:81231746-81231768
Sequence CCATGCCCCCACTCCTGTCTCGC GTCTCGCATGGGGGAGAACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 50, 4: 476} {0: 1, 1: 0, 2: 0, 3: 8, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!