ID: 1152604736_1152604743

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1152604736 1152604743
Species Human (GRCh38) Human (GRCh38)
Location 17:81283415-81283437 17:81283448-81283470
Sequence CCCGAACAGCCGGGCAAAGAAGT GTCGCCGATCACGACGTAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 85} {0: 1, 1: 0, 2: 0, 3: 1, 4: 6}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!