ID: 1152637301_1152637312

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1152637301 1152637312
Species Human (GRCh38) Human (GRCh38)
Location 17:81435390-81435412 17:81435418-81435440
Sequence CCTCGGTGCGACCCCCACTGCCC GCTCTTCCCCACGCTCCACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 181} {0: 1, 1: 0, 2: 0, 3: 27, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!