ID: 1152644115_1152644120

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1152644115 1152644120
Species Human (GRCh38) Human (GRCh38)
Location 17:81460974-81460996 17:81460990-81461012
Sequence CCAAGCGGAAGGCGGTGGCAGCG GGCAGCGGCCAGCAAGGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 135} {0: 1, 1: 0, 2: 1, 3: 35, 4: 459}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!