ID: 1152644773_1152644785

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1152644773 1152644785
Species Human (GRCh38) Human (GRCh38)
Location 17:81463709-81463731 17:81463756-81463778
Sequence CCGGAGCCGCAAGTGCCAGGACC GCACCTACGACCCCACCACCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 4, 4: 132} {0: 1, 1: 0, 2: 2, 3: 11, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!